| Patient Education |
|
Click here for patient education.
|
|
You are in: eMedicine Specialties >
Dermatology > PEDIATRIC DISEASES
Mucopolysaccharidoses Types I-VII
Article Last Updated: Feb 15, 2007
AUTHOR AND EDITOR INFORMATION
Section 1 of 11
Author: Janette Baloghova, MD, PhD, Lecturer, Department of Dermatology, Medical Faculty, University of PJ Safarik at Kosice, Slovak Republic
Coauthor(s):
Robert A Schwartz, MD, MPH, Professor and Head of Dermatology, Professor of Medicine, Professor of Pediatrics, Professor of Pathology, Professor of Preventive Medicine and Community Health, UMDNJ-New Jersey Medical School;
Zuzana Baranova, MD, PhD, Senior Lecturer, Department of Dermatology, University of PJ Safarik at Kosice, Slovak Republic
Editors: Jacek C Szepietowski, MD, PhD, Professor and Vice-Head, Department of Dermatology, Venereology and Allergology, Wroclaw Medical University, Poland; David F Butler, MD, Professor of Dermatology, Texas A&M University College of Medicine; Director, Division of Dermatology, Scott and White Clinic; Director Dermatology Residency Training Program, Scott and White Clinic; Jeffrey J Miller, MD, Associate Professor, Department of Dermatology, Penn State University, Milton S Hershey Medical Center; Catherine Quirk, MD, Clinical Assistant Professor, Department of Dermatology, Brown University; William D James, MD, Paul R Gross Professor of Dermatology, University of Pennsylvania School of Medicine; Vice-Chair, Program Director, Department of Dermatology, University of Pennsylvania Health System
Author and Editor Disclosure
Synonyms and related keywords:
MPS, lysosomal storage disease, glycosaminoglycans, GAGs, MPS type I-H, Hurler syndrome, MPS type I-S, Scheie syndrome, MPS type V, MPS type I-H/S, Hurler-Scheie syndrome, MPS type II, Hunter syndrome, MPS type III-A, Sanfilippo syndrome type A, MPS III-B, Sanfilippo syndrome type B, MPS III-C, Sanfilippo syndrome type C, MPS type III-D, Sanfilippo syndrome type D, MPS type IV-A, Morquio syndrome, MPS type IV-B, MPS type VI, Maroteaux-Lamy syndrome, MPS type VII, Sly syndrome
Background
Mucopolysaccharidoses (MPSs) are a group of lysosomal storage diseases, each of which is produced by an inherited deficiency of an enzyme involved in the degradation of acid mucopolysaccharides, now called glycosaminoglycans (GAGs). These diseases are autosomal recessive, except for MPS type II, which is X-linked.
Pathophysiology
GAGs are long, linear polysaccharide molecules composed of repeating dimers, each of which contains a hexuronic acid (or galactose in the case of keratan sulfate) and an amino sugar. The large proteoglycan molecules made up of protein cores, and GAG branches are secreted by cells and constitute a significant fraction of the extracellular matrix of connective tissue. The turnover of these molecules depends on their subsequent internalization by endocytosis, their delivery to the lysosomes, and their digestion by lysosomal enzymes. The enzyme deficiencies lead to the accumulation of mucopolysaccharides in the lysosomes of the cells in the connective tissue and to an increase in their excretion in the urine. The types of MPSs linked to specific enzyme deficiencies are listed below; some have been assigned an Enzyme Commission (EC) number.
Types of MPSs and Associated Enzyme Deficiencies
| MPS Type |
Syndrome Name |
Deficiency |
EC Number |
| MPS type I-H |
Hurler syndrome |
Alpha-L-iduronidase |
3.2.1.76 |
MPS type I-S
(formerly MPS type V) |
Scheie syndrome |
Alpha-L-iduronidase |
N/A |
| MPS type I-H/S |
Hurler-Scheie syndrome |
Alpha-L-iduronidase |
N/A |
| MPS type II, mild |
Hunter syndrome, mild form |
L-sulfoiduronate sulfatase |
N/A |
| MPS type II, severe |
Hunter syndrome, severe form |
L-sulfoiduronate sulfatase |
3.1.6.13 |
| MPS type III-A |
Sanfilippo syndrome type A |
Heparan sulfate sulfamidase |
3.1.6.14 |
| MPS type III-B |
Sanfilippo syndrome type B |
N-acetyl-alpha-D-glucosaminidase |
3.2.1.50 |
| MPS type III-C |
Sanfilippo syndrome type C |
Acetyl-coenzyme A (CoA): alpha-glucosamide N-acetyltransferase |
2.3.1.3 |
| MPS type III-D |
Sanfilippo syndrome type D |
N-acetyl-alpha-D-glucosamine-6-sulfatase |
3.1.6.14 |
| MPS type IV-A |
Morquio syndrome, classic form |
N-acetylgalactosamine-6-sulfatase (gal-6-sulfatase) |
3.1.6.4 |
| MPS type IV-B |
Morquiolike syndrome |
Beta-galactosidase |
3.2.1.23 |
| MPS type VI |
Maroteaux-Lamy syndrome, mild form |
N-acetylgalactosamine-4-sulfatase (arylsulfatase B) |
N/A |
| MPS type VI |
Maroteaux-Lamy syndrome, severe form |
N-acetylgalactosamine-4-sulfatase (arylsulfatase B) |
3.1.6.1 |
| MPS type VII |
Sly syndrome |
Beta-glucuronidase |
3.2.1.31 |
The enzyme synthesis is controlled at the following gene loci:
- 4p16.3 (Hurler syndrome, Scheie syndrome): The activity of alpha-L-iduronidase is decreased in Hurler syndrome and Scheie syndrome. However, Hurler syndrome is a severe form of the same heavy MPS, with affected children dying after several years, whereas Scheie disease has a mild clinical phenotype. In some populations, premature stop mutations represent roughly two thirds of the mutations that cause Hurler syndrome.
- 12q14 (Sanfilippo syndrome): The diagnosis requires a specific lysosomal enzyme assay for glucosamine (N-acetyl)-6-sulfatase (GNS) activity. A homozygous nonsense mutation is found in exon 9 (1063C --> T), which predicts premature termination of translation (R355X). In addition, 2 common synonymous coding single-nucleotide polymorphisms are found and genotyped in samples from 4 ethnic groups.
- 16q24.3 (Morquio syndrome): The deficiency of enzymes in Morquio syndrome type A or type B leads to the accumulation of keratan sulfate and chondroitin-6-sulfate in the connective tissue, the skeletal system, and the teeth.
- 5q11-q13 (Maroteaux-Lamy syndrome)
- Xq27.3-q28 (Hunter syndrome)
A new mutation has been reported, making a total of 15 different mutations that can cause premature stop codons in the alpha-L-iduronidase gene (IDUA), and the biochemistry of these mutations has been investigated. Natural stop codon read-through is dependent on the fidelity of the codon when evaluated at Q70X and W402X in CHO-K1 cells, but the 3 possible stop codons, TAA, TAG, and TGA, have different effects on mRNA stability, and this effect is context dependent.
In CHO-K1 cells expressing the Q70X and W402X mutations, the level of gentamicin-enhanced stop codon read-through is slightly less than the increment in activity caused by a lower-fidelity stop codon. In this system, gentamicin has more effect on read-through for the TAA and TGA stop codons compared with the TAG stop codon. In an MPS type I patient study, premature TGA stop codons were associated with a slightly attenuated clinical phenotype when compared with classic Hurler syndrome (eg, W402X/W402X and Q70X/Q70X genotypes with TAG stop codons). Natural read-through of premature stop codons is a potential explanation for the variable clinical phenotype in patients with MPS type I. Enhanced stop codon read-through is a potential treatment strategy for a large subgroup of patients with MPS type I.
In 25 Korean patients with Hunter syndrome, 20 mutations were identified, of which 13 mutations are novel: 6 small deletions (ie, 69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (ie, 21_22insG, 683_684insC), 2 terminations (ie, 529G>T, 637A>T), and 3 missense mutations (ie, 353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII restriction fragment length polymorphisms, 3 gene deletions were found. When the 20 mutations were depicted in a 3-dimensional model of iduronate 2 sulfatase protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas.
The candidate gene for MPS type IIIC has been localized to the pericentric region of chromosome 8 by linkage disequilibrium analysis.
Frequency
International
The prevalences are as follows: MPS type I-H, 1-2 cases per 100,000 population; MPS type I-S, 1 case per 250,000 population; MPS type II, 1 case per 100,000 population; MPS type III, 1 case per 25,000-75,000 population; and MPS type IV, 1 case per 40,000-200,000 population.
The prevalences of MPS types VI, VII, and I-H/S are unknown, but the prevalence of MPS type I-H/S approximates that of MPS type I-S.
According to the US National Institutes of Health, studies in Canada estimate 1 in 100,000 babies born has Hurler syndrome. The estimate for Hurler-Scheie syndrome is 1 in 115,000, and for Scheie syndrome, it is 1 in 500,000.
An epidemiologic study of the MPSs in Western Australia using multiple ascertainment sources was performed and the incidence rate for the period 1969-1996 was estimated. An incidence of approximately 1 case in 107,000 live births was obtained for MPS type I-H (Hurler phenotype); 1 case in 320,000 live births (1 in 165,000 male live births) for MPS type II (Hunter syndrome); 1 case in 58,000 for MPS III (Sanfilippo syndrome); 1 case in 640,000 for MPS type IV-A (Morquio syndrome type A); and 1 case in 320,000 for MPS type VI (Maroteaux-Lamy syndrome). The overall incidence for all types of MPS was approximately 1 case in 29,000 live births.
Mortality/Morbidity
Patients with Hurler syndrome usually die by age 5-10 years. The life expectancy of patients with Scheie syndrome may be nearly normal. They can live until the fifth or sixth decade of life, and they can have healthy offspring. As for patients with Hunter and Sanfilippo syndromes, death usually occurs by the time of puberty. In the classic form of Morquio syndrome, long-term survival is rare, with death occurring in persons aged 20-40 years. In patients with the severe form of Maroteaux-Lamy syndrome, death usually occurs by early adulthood.
Age
Onset usually occurs in early childhood.
History
MPS usually manifests during infancy or early childhood.
- The organs most involved include bone, the viscera, connective tissue, and the brain.
- Dysostosis multiplex denotes the characteristic bony abnormalities.
- Hepatosplenomegaly is a frequent finding.
- Coarse facies, retinal disease, deafness, cardiovascular anomalies, and neurologic abnormalities can be present.
- Common cutaneous findings are lichenified, dry, thick skin with diminished elasticity; increased pigmentation on the dorsum of the hands; sclerodermalike changes; hypertrichosis of the extremities; pale-colored hair; and alopecia areata.
- Obstructive sleep apnea reportedly is a finding in children with MPSs. Obstructive respiratory problems are common in patients with MPS. The severity of obstructive sleep apnea varies with each type of MPS.
- Severe neurologic deficits and mental retardation are frequently associated with disrupted ganglioside metabolism in a variety of gangliosidoses and lysosomal storage disorders.
- All types of MPSs are linked with thickened and inelastic-appearing skin. MPS type II (Hunter syndrome) reportedly is the only type with distinctive cutaneous findings; ivory-white papules or nodules 3-4 mm in diameter are present on the trunk, sometimes in a reticulate pattern. However, grouped skin-colored papules were described in a 5-year-old boy with Hurler-Scheie syndrome.
Physical
- The onset of MPS type I-H (Hurler syndrome) occurs in early childhood (ie, 6-12 mo) with the following signs:
- The skin is thickened and inelastic, as in other MPSs. Hypertrichosis is common. Grouped skin-colored papules were described in 1 child with Hurler-Scheie syndrome.
- Findings of generalized mongolian spots have been reported in newborns, which can lead to early detection and early treatment.
- Neurologic symptoms include hypertensive hydrocephalus syndrome, changes in the tonus of the musculature and the tendon reflex, and damage of the cranial nerves.
- Myxedema may occur in patients with associated hypothyroidism.
- Skeletal findings include dwarfism, with rather characteristic radiologic changes of the hands and the lumbar vertebral column; lumbar gibbus; stiff articulations; coarse facies; hip dysplasia; genu valgum; spine abnormalities; and hand abnormalities.
- Other findings include hepatosplenomegaly and cardiovascular involvement. The cardiovascular findings include cardiac murmurs at the end of the second year and valvular heart disease; coronary artery insufficiency and peripheral vascular insufficiency are late findings. Fatal cardiomyopathy with autopsy-confirmed endocardial fibroelastosis has been reported.
- CNS signs include progressive deterioration of intellect after a period of apparently normal development, debility, and speech disturbances. CNS lesions include lissencephaly, excessive ventricular enlargement and Dandy-Walker malformation with vermis atrophy, and cerebellar cysts. The association with lissencephaly is rare. The combination of mongolian spots and severe CNS lesions in Hurler syndrome is considered a rare clinical occurrence.
- Ocular symptoms include progressive clouding of the cornea, megalocornea, hereditary glaucoma, and congestion and atrophy of the optic disc.
- MPS type I-S (Scheie syndrome) usually occurs in persons aged 5-15 years.
- Skeletal findings include mild skeletal deformation and deformity of the hands. Growth may be normal.
- Aortic stenosis or regurgitation may be present.
- Hepatosplenomegaly may be present.
- Intelligence is usually normal.
- The clinical signs of MPS type I-H/S (Hurler-Scheie syndrome) begin in persons aged 2-4 years; the signs are the same as those of MPS type I-H, but they are milder with a slower progression.
- MPS type II (Hunter syndrome) manifests in persons aged 1-3 years.
- Clouding of the cornea does not occur, although patients have a pigmentary change in the ocular fundus with diminution of visual acuity and deposits of mucopolysaccharides.
- Lumbar gibbus is rare in persons with Hunter syndrome.
- Progressive deafness is a major problem. This also occurs in persons with Hurler syndrome, but severe mental retardation and early death make it a relatively inconspicuous feature.
- Hepatosplenomegaly, stiff articulations, coarse facial features, and cardiovascular involvement occur as in Hurler syndrome.
- Cutaneous manifestations include hirsutism; thickening of the skin, particularly over the fingers; and multiple, ivory-white, pebbly papules or nodules overlying the scapula and in the area of the posterior axillary fold. These nodules are most often localized symmetrically between the scapula angle and the linea axillaris posterior or on the thorax and the neck.
- Papules with a pebbly appearance are a specific marker for the disease. These papules fade away through the digestion of a large amount of hyaluronic acid in cutaneous tissues by normal tissue histiocytes or enzymes of donor origin at an early stage after hematopoietic stem cell transplantation (SCT).
- The brain MRI abnormalities in patients with MPS types I and II who have only mild clinical manifestations are abnormal signal intensity in the white matter, widening of the cortical sulci, the size of the supratentorial ventricles, dilatation of the perivascular spaces, and enlargement of the subarachnoid spaces.
- The main findings of MPS type III (Sanfilippo syndrome) are regression of psychomotor development and neurologic signs (eg, hyperactivity, autistic features, behavioral disorder), which occur in children aged 2-6 years.
- The sleep disruption in Sanfilippo syndrome consists of an irregular sleep/wake pattern, which at its onset might appear as a disorder of initiating or maintaining sleep. This could explain why some patients do not respond to conventional hypnotics.
- Dysmorphic features are relatively rare.
- Other signs include thickened facial features, coarse hair, genu valgum, and a short neck. Hirsutism is common.
- Children become inattentive and deteriorate rapidly, losing the power of speech.
- Mild hepatosplenomegaly is common.
- The course of the disease is progressive; most patients die before age 20 years.
- Osteoporosis and osteomalacia are possible skeletal effects. They probably result from nutritional deficiencies and the inability to walk, rather than from the genetic defect itself. Secondary skeletal involvement in patients with MPS type III may represent a considerable cause of morbidity and requires intervention to reduce the risk of pathological fractures.
- MPS type IV (Morquio syndrome) is characterized by abnormalities of the skeletal system (eg, kyphoscoliosis, pectus carinatum, luxation of the hips), aortic valvular disease, and dental abnormalities.
- The clinical and radiographic appearances of the teeth resemble hypoplastic amelogenesis imperfecta with thin enamel of normal radiodensity.
- Odontoid hypoplasia is common and can lead to deadly atlantoaxial instability if not treated.
- Ophthalmologically, diffuse corneal opacification and alterations of the trabecular meshwork occasionally lead to glaucoma.
- In Morquiolike syndrome, hearing deficits, dental abnormalities, cardiac murmurs, hepatomegaly, and joint laxity are absent.
- In MPS type VI, the first clinical signs usually appear in the first 2 years of life and manifest as psychomotor retardation.
- This syndrome resembles Hurler syndrome with typical facial changes.
- Slowly, the thoracic deformity appears. Lumbar kyphosis, limited joint mobility, and a claw position of the hands are also present.
- Usually, hepatosplenomegaly is present; less often, only splenomegaly is present.
- Intelligence is usually normal, but visual and hearing impairments are present.
- Compression of the spinal cord with successive neurologic complications can appear because of hypoplasia of the cervical vertebrae.
- A large head, short neck, corneal opacity, open mouth associated with an enlarged tongue, enlargement of skull, and a long anteroposterior dimension are the main characteristic features.
- Dental complications include unerupted dentition, dentigerous cystlike follicles, malocclusions, condylar defects, and gingival hyperplasia.
- Early after birth, children with MPS type VII have hepatosplenomegaly and facial deformities, such as hypertelorism, a prominent maxilla, and a depressed bridge of the nose.
- Dwarfism with pectus carinatum and kyphosis is present.
- Children have frequent upper respiratory tract infections.
- Many develop corneal clouding.
- Mental retardation is mild.
- Craniovertebral instability and spinal cord compression can occur in persons with MPS type VII (Sly syndrome), with deposition of GAGs at the craniovertebral junction.
- A very rare finding is fetal hydrops.
Causes
See Pathophysiology.
[Gaucher Disease]
Niemann-Pick Disease
Syphilis
Other Problems to be Considered
Hydrocephalus, rachitis, hypothyreosis, chondrodystrophia, and epiphyseal dysplasia (Normal thickening of diaphysis and tubular bones, irregular epiphyses, brachyspondylia, augmentation, and angulation of the spinal vertebrae are present in all these diseases.)
Osteogenesis imperfecta
Vitamin D–resistant rickets
Nephrogenic osteopathy
Syphilis connata
Spondyloepiphysial dysplasia
Metaphysial dysplasia
Lab Studies
- The diagnosis is based on the clinical picture, radiographic findings, and laboratory results.
- The diagnosis of MPS can be achieved by nonenzymatic screening methods, including the 2-dimensional electrophoresis method and the dimethylmethylene blue method.
- The 2-dimensional electrophoresis method reveals separation of urinary GAGs, and the dimethylmethylene blue method can be used to estimate the concentration of GAG in urine. Both methods are specific, sensitive, and easy to perform for MPS screening.
- Quantitation of urinary GAGs alone is not diagnostic of MPS; it should be coupled with qualitative analysis and enzyme estimations for differential/definitive diagnosis. Quantitation of isolated urinary GAGs can be performed using the acid Alcian blue complex formation method, and qualitative urinary GAG analysis can be performed by multisolvent sequential thin layer chromatography.
- Metachromatic granulations can be detected in the leukocytes in blood or bone marrow cells (Adler-Reilly granules containing GAGs).
- Measurement of iduronate-2-sulfatase (I2S) protein concentration with a 2-step, time-delayed, dissociation-enhanced lanthanide fluorescence immunoassay and enzyme activity with the fluorogenic substrate 4-methylumbelliferyl sulfate from the dried blood spots and plasma samples enables the detection of MPS type II.
Imaging Studies
- Radiographic findings are as follows:
- MPS type II: Generalized symmetric damage of the epiphysis is noted. They are flattened and augmented. The metadiaphyseal parts of the tubular bones are shortened and thickened. Valgus deformity of the proximal parts of the femur and deformation of the plate bones are observed. Thickening of the ribs and shortening of the intercostal distance are noted. Platyspondylia of the columna vertebrarum with angle kyphosis in the lumbar and thoracic regions is evident. No changes are evident in the intervertebral spatia. The basis cranii is short; the sella turcica is flattened and prolonged. Blockage of the pneumatization and asymmetric osteogenesis are present.
- MPS type IV: Epiphyseal growth is disturbed. For the columna vertebrarum, platybrachyspondylia is characteristic. No disturbances are present in the intervertebral disks. In the thorax, the anteroposterior distance is augmented, while the intercostal distance is decreased.
- MRI is the primary imaging technique to detect CNS alterations. The presence of white matter alterations is significantly correlated with mental retardation. Other possible CNS alterations are perivascular, subarachnoid, and ventricular space enlargement and abnormalities of the basal ganglia, the corpus callosum, and the atlantoaxial joint.
Other Tests
- Carrier status can be determined by performing enzymatic assays in high-risk individuals.
- Prenatal diagnosis for most of these disorders is available to high-risk mothers, such as mothers of an affected offspring, who face a 25% chance of having another affected offspring in a subsequent pregnancy.
- In MPS type III, flash visual evoked potentials and brainstem auditory evoked potentials are almost always normal; electroencephalography findings are often abnormal early in the disease.
- Patients who present with progressive noninflammatory joint involvement in the first decade of life, particularly with stiffness of the fingers and difficulty using the hands, should be screened for metabolic diseases, including MPS type I. MPS type I should be considered if patients with arthropathy lack the typical characteristics of inflammatory arthropathy.
- Screening for vitreous abnormalities and maculopathy may be important in diagnosing, treating, and explaining visual loss in persons with Hunter syndrome.
Histologic Findings
In all types of MPS, normal or slightly thickened skin shows metachromatic granules within the fibroblasts by using Giemsa or toluidine blue staining. These metachromatic granules are occasionally evident within keratinocytes and eccrine structures. The characteristic cutaneous pebbling in Hunter syndrome shows these granules within the dermal fibroblasts and extracellular metachromatic material between the collagen bundles. In all types of MPS, the cytoplasm of circulating lymphocytes also demonstrates these granules. Patients with Morquio syndrome show reduced activity of N-acetyl-galactosamine-6-sulfatase on fibroblast culture obtained from a skin biopsy sample.
Medical Care
Current therapies
In patients with MPS type I, treatment with recombinant human alpha-L-iduronidase reduces lysosomal storage in the liver and ameliorates some clinical manifestations of the disease.
In patients with MPS type I, laronidase significantly improves respiratory function and physical capacity, reduces GAG storage, and has a favorable safety profile.
A Hurler syndrome fibroblast cell line heterozygous for the IDUA gene that encodes alpha-L-iduronidase stop mutations Q70X or W402X shows a significant increase in alpha-L-iduronidase activity when cultured in the presence of gentamicin, resulting in the restoration of 2.8% of the normal alpha-L-iduronidase activity.
Allogeneic bone marrow transplantation (BMT) is the only long-lasting treatment that ameliorates or halts the aggressive course of the disease. Pulmonary hemorrhage is an unusual complication of BMT.
Allogeneic hematopoietic SCT, used in severe forms of the disease, markedly prolongs survival, alleviates ventricular hypertrophy, and preserves cardiac function, but cardiac valves continue to thicken and valvular insufficiency progresses.
Cell therapy with human amniotic epithelial cells was developed as an alternative method for enzyme replacement therapy in congenital lysosomal storage disorders, but only limited therapeutic efficacy has been reported. Some studies suggest that the transplantation of human amniotic epithelial cells transduced with adenoviral vectors can be used for the treatment of congenital lysosomal storage disorders. The multiple positive effects include reconstruction of the CNS.
Neonatal screening of these diseases should be mandatory to vastly improve outcomes. Plans are being implemented to use dried blood spots on filter paper, as is commonly performed for many other genetic diseases. Many new therapies are being adopted, which should enhance positivity and acceptance of treatment by hematopoietic SCT.
Many children who undergo SCT have deterioration in hearing following SCT. A high-risk group of children can be delineated who may benefit from more intensive audiologic monitoring following SCT.
For Maroteaux-Lamy syndrome, BMT is the only definitive form of enzyme replacement therapy available. Umbilical cord blood transplantation has also been reported as a treatment of this syndrome.
Therapy with glucocorticoids, high doses of vitamin A, thyroid hormone, lidase, and growth hormone has been attempted. Glucocorticoids and a corticotropin have been used to block the synthesis of acid mucopolysaccharides. High doses of vitamin A have been used in an effort to increase the urinary excretion of mucopolysaccharides; however, the amount excreted and the clinical response have varied. Lidase is a hyaluronidase that digests mucopolysaccharides. Thyroid hormone substitution is used in patients with hypothyroidism. Some patients with MPS are shown to have growth hormone deficiency, and in these cases, growth hormone therapy may be beneficial. Symptomatic anticonvulsive therapy is indicated when epilepsy is present. The prognosis is better and therapy is more successful when treatment is started early.
Treatment with recombinant human N-acetylgalactosamine 4-sulfatase (rhASB) is another possibility in MPS type VI. rhASB treatment reportedly was well-tolerated, and reduced lysosomal storage is evidenced by a dose-dependent reduction in urinary GAG.
Treatments in clinical trials
No cure exists for MPS; treatment is symptomatic and supportive. However, possible treatments are being investigated in several clinical trials.
MPS type I
Laronidase (Aldurazyme) is an enzyme replacement therapy for patients with MPS type I, a progressive, debilitating, and fatal genetic disease for which specific drug treatments currently are available. In a press release in September 2002, BioMarin and Genzyme included clinical data from the 6-month, placebo-controlled, phase 3 trial of laronidase; 6 months of data from the ongoing open-label, phase 3 extension study; and 3 years of data from the phase 1 trial and extension study. Laronidase was approved in the United States in April 2003.
The study of a double-blinded, placebo-controlled trial reported by Muenzer et al supports the use of weekly infusions of idursulfase in the treatment of MPS type II. Idursulfase was generally well tolerated, but infusion reactions did occur. Idursulfase antibodies were detected in 46.9% of patients.
MPS type II
In a press release from October 2002, Transkaryotic Therapies Inc (TKT) reported results from a phase 1/2 study evaluating its investigational enzyme replacement therapy with I2S as a treatment of Hunter syndrome. The randomized, double-blinded, placebo-controlled study evaluated the safety of I2S (human I2S produced by genetic engineering technology) and its clinical activity in 12 patients with Hunter syndrome. Three doses were studied (0.15 mg/kg, 0.5 mg/kg, and 1.5 mg/kg), and within each dose group, 3 patients were randomized to receive I2S and 1 was to receive placebo by a 60-min intravenous infusion biweekly for 6 months.
In the trial, I2S administration was generally well tolerated, and in the phase 1/2 trials, evidence of clinical activity with Hunter syndrome, including reduced cardiac mass, stabilized pulmonary function, and reduced GAG levels, was demonstrated. The most common adverse effects from I2S treatment were hives, chills, fever, and facial flushing. Only 1 of the 9 patients who were treated developed antibody to I2S.
MPS type IV-A
BioMarin Pharmaceutical is developing a program to administer the missing enzyme galactose-6-sulfatase to individuals with MPS type IV-A. Studies in MPS types VI and VII animal models suggest that if given early, the enzyme can potentially change the outcome of bone and cartilage disease. Currently, no clinical trial is planned.
MPS type VI
The clinical trial of rhASB (Aryplase), an investigational enzyme replacement therapy for MPS type VI, continues to evaluate the efficacy, safety, and pharmacokinetics of weekly intravenous infusions of 1 mg/kg of rhASB in 10 patients with MPS type VI. In June 2002, BioMarin Pharmaceutical announced findings from the 24-week open-label extension of the phase 1 clinical trial; the enzyme was well tolerated by all patients, and reduced urinary excretion of GAG was maintained in both treatment arms.
It was confirmed in the phase 3 of the randomized, double-blinded, placebo-controlled, multicenter, multinational study that rhASB significantly improves endurance, reduces urinary GAG excretion, and has an acceptable safety profile. After 24 weeks, patients receiving rhASB walked on average 92 meter more in the 12-minute walk test and climbed 5.7 stairs per minute more in a 3-minute stair climb test than patients receiving placebo. Urinary GAG declined by -227 ±18 mcg/mg more with rhASB than placebo. Patients exposed to the drug experienced positive clinical benefits despite the presence of antibody to the protein.
MPS type VII
Emil Kakkis, MD, PhD, and William Sly, MD, have received a grant to develop enzyme replacement for MPS type VII. They are making steady progress with BioMarin Pharmaceutical, but no timeline for human clinical trials is projected.
Surgical Care
Treatment is symptomatic. Surgical procedures may include corneal transplantation, correction of nerve entrapments in the hands, and heart valve replacement.
Correction of the contractures and osteal deformities may be performed. For patients with MPS type IV, cervical myelopathy should be prevented by surgery of the cervical spine.
Occipital to C3 decompression and fusion with autogenous rib grafts may be performed. The youngest patient who underwent this successful posterior cervical arthrodesis was 17-month-old boy with Sly syndrome.
Consultations
Genetic counseling is of great importance to ensure prenatal diagnosis.
MPSs create a special challenge for the otolaryngologist. With the rare types of MPS type IV and MPS type I-S, a skilled practitioner is required to manage airway complications. The erratic deposits of mucopolysaccharides throughout the trachea should be taken into account when a decision is made to stent the airway. Proper management requires an airway that is custom made to meet the patient's needs.
N-acetylgalactosamine-4-sulfatase is a recombinant human enzyme used to treat MPS type VI (Maroteaux-Lamy syndrome). Most attempts at enzyme replacement in various forms of MPS have not been successful. Alpha-L-iduronidase is a recombinant human enzyme used to treat MPS type I that received US patent approval in November 2001 and was approved in April 2003 as a proprietary product. Laronidase (Aldurazyme), present in cell lysosomes, helps to break down mucopolysaccharides. In MPS type I patients, mucopolysaccharides accumulate in organs and tissues, particularly in the CNS, the liver, the spleen, the heart, and the skeleton. This accumulation leads to cell death and progressive tissue and organ damage.
Drug Category: Enzymes
Enzyme replacement therapy with laronidase may provide clinically important benefits (ie, improved pulmonary function and walking ability, reduced excess carbohydrates stored in organs).
| Drug Name | Laronidase (Aldurazyme) |
| Description | Indicated to treat MPS type I (Hurler syndrome, Scheie syndrome, Hurler-Scheie syndrome). Used to increase catabolism of GAGs, which accumulate with MPS type I. Treatment has shown to improve walking capacity and pulmonary function. Laronidase is a polymorphic variant of the human enzyme alpha-L-iduronidase produced by recombinant DNA technology. |
| Adult Dose | 0.58 mg/kg IV qwk administered over 4 h; initiate at IV infusion rate of 10 mcg/kg/h and increase incrementally q15min as tolerated within first h; not to exceed 200 mcg/kg/h |
| Pediatric Dose | <5 years: Not established >5 years: Administer as in adults |
| Contraindications | Documented hypersensitivity (consider risks and benefits of readministering drug following severe hypersensitivity reaction; exercise extreme care with appropriate resuscitation measures if decision is made to readminister product) |
| Interactions | None reported |
| Pregnancy | B - Usually safe but benefits must outweigh the risks.
|
| Precautions | Antibodies to laronidase develop by 12 wk; infusion-related hypersensitivity (eg, flushing, headache, rash, fever) reactions may occur (decreasing infusion rate or administering antihistamines may diminish symptoms) |
| Drug Name | Idursulfase (Elaprase) |
| Description | Purified form of human I2S, a lysosomal enzyme. Hydrolyzes 2-sulfate esters of terminal iduronate sulfate residues from the GAGs dermatan sulfate and heparan sulfate in the lysosomes of various cell types. Indicated for MPS type II (Hunter syndrome) because replaces insufficient levels of the lysosomal enzyme I2S. |
| Adult Dose | 0.5 mg/kg IV qwk; total volume typically infused over 1-3 h; initiate at rate of 8 mL/h for first 14 min; if tolerated, may increase by 8-mL/h increments q15min; not to exceed 100 mL/h |
| Pediatric Dose | <5 years: Not established >5 years: Administer as in adults |
| Contraindications | Documented hypersensitivity |
| Interactions | None reported |
| Pregnancy | C - Safety for use during pregnancy has not been established.
|
| Precautions | Anaphylactoid reactions have occurred (additional monitoring required, especially for individuals with respiratory compromise); appropriate medical support should be available during infusion, and premedication with antihistamines and/or corticosteroids recommended prior to infusion; common adverse effects include infusion-related reactions (eg, pyrexia, headache, arthralgia, pruritus, malaise, visual disturbance, musculoskeletal pain, urticaria) |
Deterrence/Prevention:
- Genetic counseling may be performed.
- Prenatal diagnosis is possible. Amniocentesis can be performed; cells in the amniotic fluid are cultured, and the alpha-L-iduronidase activity in the cells is determined.
Complications:
- MPS type I (Hurler syndrome): Complications include heart valve damage from thickening due to coronary artery disease, severe mental retardation, umbilical and inguinal hernia, deafness, premature death, and constipation alternating with diarrhea.
- MPS type II (Hunter syndrome): Complications include airway obstruction in the late-onset form, progressive mental deterioration in the early-onset form (severe form), progressive loss of ability to perform daily living activities in the early-onset form (severe form), progressive hearing loss in both the mild and severe forms, progressive joint stiffness leading to contractures of the joints in the early-onset form (severe form), and carpal tunnel syndrome. Of the complications observed after tracheotomy, infrastomal tracheal stenosis and stomal narrowing are frequent.
- MPS type III (Sanfilippo syndrome): Complications include blindness, seizures, mental retardation, progressive neurologic disease leading to patients becoming wheelchair bound, and the inability to care for oneself.
- MPS type IV (Morquio syndrome): Complications include heart failure, difficulty with vision, walking problems due to abnormal curvature of the spine, and breathing problems. Abnormal neck bones can cause spinal cord damage that can result in severe disease, including paralysis, if not noticed early. Spinal fusion can prevent this complication.
- MPS type VI (Maroteaux-Lamy syndrome): Complications include hearing loss, vision loss, carpal tunnel syndrome, and valvular heart disease.
Prognosis:
- MPS type I (Hurler syndrome): Patients with Hurler syndrome have a poor prognosis. Children with this disease have significant progressive physical and mental deficiencies. Death can occur in late childhood, early adolescence, or adulthood.
- MPS type II (Hunter syndrome): The life expectancy for the early-onset form (severe form) is 10-20 years; for the late-onset form (mild form), it is 20-60 years.
- MPS type III (Sanfilippo syndrome): Severe retardation is the most important of the clinical problems. Patients may have IQs below 50. Severe cases lead to death before the patient is aged 20 years. In a minority of cases, it is compatible with a normal lifespan.
- MPS type IV (Morquio syndrome): Bony abnormalities represent a significant problem. Small vertebrae at the top of the neck can cause slippage that damages the spinal cord, possibly resulting in paralysis. Death may occur as a result of cardiac complications.
- MPS type VI (Maroteaux-Lamy syndrome): The life expectancy is the second to third decade of life, with patients dying from heart failure. Patients may die earlier from cardiac or neurologic complications, depending on the severity of disease.
Patient Education:
Special Concerns
- Within the first 3 months of pregnancy, intrauterine diagnosis is possible by analysis of the fibroblast culture obtained from amnionic fluid.
The authors and editors of eMedicine gratefully acknowledge the contributions of previous author, Alexander Halagovec, MD, PhD, to the development and writing of this article.
- Alpoz AR, Coker M, Celen E, et, al. The oral manifestations of Maroteaux-Lamy syndrome (mucopolysaccharidosis VI): a case report. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. May 2006;101(5):632-7. [Medline].
- Anawis MA. Hunter syndrome (MPS II-B): a report of bilateral vitreous floaters and maculopathy. Ophthalmic Genet. Jun 2006;27(2):71-2. [Medline].
- Ashrafi MR, Shabanian R, Mohammadi M, Kavusi S. Extensive Mongolian spots: a clinical sign merits special attention. Pediatr Neurol. Feb 2006;34(2):143-5. [Medline].
- Braunlin EA, Berry JM, Whitley CB. Cardiac findings after enzyme replacement therapy for mucopolysaccharidosis type I. Am J Cardiol. Aug 2006;98(3):416-8. [Medline].
- Caillaud C, Poenaru L. Gene therapy in lysosomal diseases. Biomed Pharmacother. Oct 2000;54(10):505-12. [Medline].
- Cimaz R, Vijay S, Haase C, et, al. Attenuated type I mucopolysaccharidosis in the differential diagnosis of juvenile idiopathic arthritis: a series of 13 patients with Scheie syndrome. Clin Exp Rheumatol. Mar-Apr 2006;24(2):196-202. [Medline].
- Dean CJ, Bockmann MR, Hopwood JJ, Brooks DA, Meikle PJ. Detection of mucopolysaccharidosis type II by measurement of iduronate-2-sulfatase in dried blood spots and plasma samples. Clin Chem. Apr 2006;52(4):643-9. [Medline].
- Demitsu T, Kakurai M, Okubo Y, et al. Skin eruption as the presenting sign of Hunter syndrome IIB. Clin Exp Dermatol. May 1999;24(3):179-82. [Medline].
- Dickerman RD, Colle KO, Bruno CA, Schneider SJ. Craniovertebral instability with spinal cord compression in a 17-month-old boy with Sly syndrome (mucopolysaccharidosis type VII): a surgical dilemma. Spine. Mar 1 2004;29(5):E92-4. [Medline].
- Fu H, Samulski RJ, McCown TJ, et al. Neurological correction of lysosomal storage in a mucopolysaccharidosis IIIB mouse model by adeno-associated virus-mediated gene delivery. Mol Ther. Jan 2002;5(1):42-9. [Medline].
- Gabrielli O, Polonara G, Regnicolo L, et al. Correlation between cerebral MRI abnormalities and mental retardation in patients with mucopolysaccharidoses. Am J Med Genet A. Mar 15 2004;125(3):224-31. [Medline].
- Gallegos-Arreola MP, Machorro-Lazo MV, Flores-MartÃnez SE, et al. Urinary glycosaminoglycan excretion in healthy subjects and in patients with mucopolysaccharidoses. Arch Med Res. Sep-Oct 2000;31(5):505-10. [Medline].
- Gassas A, Sung L, Doyle JJ, et al. Life-threatening pulmonary hemorrhages post bone marrow transplantation in Hurler syndrome. Report of three cases and review of the literature. Bone Marrow Transplant. Jul 2003;32(2):213-5. [Medline].
- Gosele S, Dithmar S, Holz FG, Volcker HE. [Late diagnosis of Morquio syndrome. Clinical histopathological findings in a rare mucopolysaccharidosis]. Klin Monatsbl Augenheilkd. Aug 2000;217(2):114-7. [Medline].
- Grewal SS, Krivit W, Defor TE. Outcome of second hematopoietic cell transplantation in Hurler syndrome. Bone Marrow Transplant. Mar 2002;29(6):491-6. [Medline].
- Harmatz P, Whitley CB, Waber L, et al. Enzyme replacement therapy in mucopolysaccharidosis VI (Maroteaux-Lamy syndrome). J Pediatr. May 2004;144(5):574-80. [Medline].
- Harmatz P, Giugliani R, Schwartz I, Guffon N, Teles EL, Miranda MC, et al. Enzyme replacement therapy for mucopolysaccharidosis VI: a phase 3, randomized, double-blind, placebo-controlled, multinational study of recombinant human N-acetylgalactosamine 4-sulfatase (recombinant human arylsulfatase B or rhASB) and follow-on, open-. J Pediatr. Apr 2006;148(4):533-539. [Medline].
- Hein LK, Bawden M, Muller VJ, et al. alpha-L-iduronidase premature stop codons and potential read-through in mucopolysaccharidosis type I patients. J Mol Biol. Apr 30 2004;338(3):453-62. [Medline].
- Husain AM, Escolar ML, Kurtzberg J. Neurophysiologic assessment of mucopolysaccharidosis III. Clin Neurophysiol. Sep 2006;117(9):2059-63. [Medline].
- Ito K, Ochiai T, Suzuki H, et al. The effect of haematopoietic stem cell transplant on papules with 'pebbly' appearance in Hunter's syndrome. Br J Dermatol. Jul 2004;151(1):207-11. [Medline].
- Jeong HS, Cho DY, Ahn KM, Jin DK. Complications of tracheotomy in patients with mucopolysaccharidoses type II (Hunter syndrome). Int J Pediatr Otorhinolaryngol. Oct 2006;70(10):1765-9. [Medline].
- Kakavanos R, Turner CT, Hopwood JJ, et al. Immune tolerance after long-term enzyme-replacement therapy among patients who have mucopolysaccharidosis I. Lancet. May 10 2003;361(9369):1608-13. [Medline].
- Kakkis ED, Muenzer J, Tiller GE, et al. Enzyme-replacement therapy in mucopolysaccharidosis I. N Engl J Med. Jan 18 2001;344(3):182-8. [Medline].
- Keeling KM, Brooks DA, Hopwood JJ. Gentamicin-mediated suppression of Hurler syndrome stop mutations restores a low level of alpha-L-iduronidase activity and reduces lysosomal glycosaminoglycan accumulation. Hum Mol Genet. Feb 1 2001;10(3):291-9. [Medline].
- Kim CH, Hwang HZ, Song SM, et al. Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations. Hum Mutat. Apr 2003;21(4):449-50. [Medline].
- Krivit W. Allogeneic stem cell transplantation for the treatment of lysosomal and peroxisomal metabolic diseases. Springer Semin Immunopathol. Nov 2004;26(1-2):119-32. [Medline].
- Lee V, Li CK, Shing MM, et al. Umbilical cord blood transplantation for Maroteaux-Lamy syndrome (mucopolysaccharidosis type VI). Bone Marrow Transplant. Aug 2000;26(4):455-8. [Medline].
- Leighton SE, Papsin B, Vellodi A, et al. Disordered breathing during sleep in patients with mucopolysaccharidoses. Int J Pediatr Otorhinolaryngol. Apr 27 2001;58(2):127-38. [Medline].
- Mahalingam K, Janani S, Priya S, et al. Diagnosis of mucopolysaccharidoses: how to avoid false positives and false negatives. Indian J Pediatr. Jan 2004;71(1):29-32. [Medline].
- Mariotti P, Della Marca G, Iuvone L, et al. Sleep disorders in Sanfilippo syndrome: a polygraphic study. Clin Electroencephalogr. Jan 2003;34(1):18-22. [Medline].
- Matheus MG, Castillo M, Smith JK, et al. Brain MRI findings in patients with mucopolysaccharidosis types I and II and mild clinical presentation. Neuroradiology. Aug 2004;46(8):666-72. [Medline].
- Mok A, Cao H, Hegele RA. Genomic basis of mucopolysaccharidosis type IIID (MIM 252940) revealed by sequencing of GNS encoding N-acetylglucosamine-6-sulfatase. Genomics. Jan 2003;81(1):1-5. [Medline].
- Muenzer J, Wraith JE, Beck M, Giugliani R, Harmatz P, Eng CM, et al. A phase II/III clinical study of enzyme replacement therapy with idursulfase in mucopolysaccharidosis II (Hunter syndrome). Genet Med. Aug 2006;8(8):465-73. [Medline].
- Nelson J, Crowhurst J, Carey B, Greed L. Incidence of the mucopolysaccharidoses in Western Australia. Am J Med Genet A. Dec 15 2003;123(3):310-3. [Medline].
- Panteliadis CP, Karatza ED, Tzitiridou MK, et al. Lissencephaly and mongolian spots in Hurler syndrome. Pediatr Neurol. Jul 2003;29(1):59-62. [Medline].
- Prystowsky SD, Maumenee IH, Freeman RG, et al. A cutaneous marker in the Hunter syndrome a report of four cases. Arch Dermatol. May 1977;113(5):602-5. [Medline].
- Punnett A, Bliss B, Dupuis LL, et al. Ototoxicity following pediatric hematopoietic stem cell transplantation: a prospective cohort study. Pediatr Blood Cancer. Jun 2004;42(7):598-603. [Medline].
- Rigante D, Caradonna P. Secondary skeletal involvement in Sanfilippo syndrome. QJM. Apr 2004;97(4):205-9. [Medline].
- Ross CJ, Bastedo L, Maier SA, et al. Treatment of a lysosomal storage disease, mucopolysaccharidosis VII, with microencapsulated recombinant cells. Hum Gene Ther. Oct 10 2000;11(15):2117-27. [Medline].
- Sands MS, Barker JE, Vogler C, et al. Treatment of murine mucopolysaccharidosis type VII by syngeneic bone marrow transplantation in neonates. Lab Invest. Jun 1993;68(6):676-86. [Medline].
- Sapadin AN, Friedman IS. Extensive Mongolian spots associated with Hunter syndrome. J Am Acad Dermatol. Dec 1998;39(6):1013-5. [Medline].
- Schiro JA, Mallory SB, Demmer L, et al. Grouped papules in Hurler-Scheie syndrome. J Am Acad Dermatol. Nov 1996;35(5 Pt 2):868-70. [Medline].
- Scriver RC, Beaudet AL, Sly WS. The Metabolic and Molecular Bases of Inherited Disease. New York, NY:. McGraw-Hill;1995.
- Seyrantepe V, Tihy F, Pshezhetsky AV. The microcell-mediated transfer of human chromosome 8 restores the deficient N-acetylytransferase activity in skin fibroblasts of Mucopolysaccharidosis type IIIC patients. Hum Genet. Sep 2006;120(2):293-6. [Medline].
- Shinhar SY, Zablocki H, Madgy DN. Airway management in mucopolysaccharide storage disorders. Arch Otolaryngol Head Neck Surg. Feb 2004;130(2):233-7. [Medline].
- Venkat-Raman N, Sebire NJ, Murphy KW. Fetal hydrops due to mucopolysaccharidosis type VII is very rare. Fetal Diagn Ther. 2006;21(3):250-4. [Medline].
- Weisstein JS, Delgado E, Steinbach LS, et al. Musculoskeletal manifestations of Hurler syndrome: long-term follow-up after bone marrow transplantation. J Pediatr Orthop. Jan-Feb 2004;24(1):97-101. [Medline].
- Whitley CB, Belani KG, Chang PN, et al. Long-term outcome of Hurler syndrome following bone marrow transplantation. Am J Med Genet. Apr 15 1993;46(2):209-18. [Medline].
- Wolanczyk T, Banaszkiewicz A, Mierzewska H, et al. [Hyperactivity and behavioral disorders in Sanfilippo A (mucopolysaccharidosis type IIIA)--case report and review of the literature]. Psychiatr Pol. Sep-Oct 2000;34(5):831-7. [Medline].
- Wraith JE, Clarke LA, Beck M, et al. Enzyme replacement therapy for mucopolysaccharidosis I: a randomized, double-blinded, placebo-controlled, multinational study of recombinant human alpha-L-iduronidase (laronidase). J Pediatr. May 2004;144(5):581-8. [Medline].
Mucopolysaccharidoses Types I-VII excerpt Article Last Updated: Feb 15, 2007
|