Excerpt from Mucopolysaccharidoses Types I-VII

Please click here to view the full topic text: Mucopolysaccharidoses Types I-VII

Background

Mucopolysaccharidoses (MPSs) are a group of lysosomal storage diseases, each of which is produced by an inherited deficiency of an enzyme involved in the degradation of acid mucopolysaccharides, now called glycosaminoglycans (GAGs). These diseases are autosomal recessive, except for MPS type II, which is X-linked.

Pathophysiology

GAGs are long, linear polysaccharide molecules composed of repeating dimers, each of which contains a hexuronic acid (or galactose in the case of keratan sulfate) and an amino sugar. The large proteoglycan molecules made up of protein cores, and GAG branches are secreted by cells and constitute a significant fraction of the extracellular matrix of connective tissue. The turnover of these molecules depends on their subsequent internalization by endocytosis, their delivery to the lysosomes, and their digestion by lysosomal enzymes. The enzyme deficiencies lead to the accumulation of mucopolysaccharides in the lysosomes of the cells in the connective tissue and to an increase in their excretion in the urine. The types of MPSs linked to specific enzyme deficiencies are listed below; some have been assigned an Enzyme Commission (EC) number.

Types of MPSs and Associated Enzyme Deficiencies

MPS Type	Syndrome Name	Deficiency	EC Number
MPS type I-H	Hurler syndrome	Alpha-L-iduronidase	3.2.1.76
MPS type I-S (formerly MPS type V)	Scheie syndrome	Alpha-L-iduronidase	N/A
MPS type I-H/S	Hurler-Scheie syndrome	Alpha-L-iduronidase	N/A
MPS type II, mild	Hunter syndrome, mild form	L-sulfoiduronate sulfatase	N/A
MPS type II, severe	Hunter syndrome, severe form	L-sulfoiduronate sulfatase	3.1.6.13
MPS type III-A	Sanfilippo syndrome type A	Heparan sulfate sulfamidase	3.1.6.14
MPS type III-B	Sanfilippo syndrome type B	N-acetyl-alpha-D-glucosaminidase	3.2.1.50
MPS type III-C	Sanfilippo syndrome type C	Acetyl-coenzyme A (CoA): alpha-glucosamide N-acetyltransferase	2.3.1.3
MPS type III-D	Sanfilippo syndrome type D	N-acetyl-alpha-D-glucosamine-6-sulfatase	3.1.6.14
MPS type IV-A	Morquio syndrome, classic form	N-acetylgalactosamine-6-sulfatase (gal-6-sulfatase)	3.1.6.4
MPS type IV-B	Morquiolike syndrome	Beta-galactosidase	3.2.1.23
MPS type VI	Maroteaux-Lamy syndrome, mild form	N-acetylgalactosamine-4-sulfatase (arylsulfatase B)	N/A
MPS type VI	Maroteaux-Lamy syndrome, severe form	N-acetylgalactosamine-4-sulfatase (arylsulfatase B)	3.1.6.1
MPS type VII	Sly syndrome	Beta-glucuronidase	3.2.1.31

The enzyme synthesis is controlled at the following gene loci:

• 4p16.3 (Hurler syndrome, Scheie syndrome): The activity of alpha-L-iduronidase is decreased in Hurler syndrome and Scheie syndrome. However, Hurler syndrome is a severe form of the same heavy MPS, with affected children dying after several years, whereas Scheie disease has a mild clinical phenotype. In some populations, premature stop mutations represent roughly two thirds of the mutations that cause Hurler syndrome.
• 12q14 (Sanfilippo syndrome): The diagnosis requires a specific lysosomal enzyme assay for glucosamine (N-acetyl)-6-sulfatase (GNS) activity. A homozygous nonsense mutation is found in exon 9 (1063C --> T), which predicts premature termination of translation (R355X). In addition, 2 common synonymous coding single-nucleotide polymorphisms are found and genotyped in samples from 4 ethnic groups.
• 16q24.3 (Morquio syndrome): The deficiency of enzymes in Morquio syndrome type A or type B leads to the accumulation of keratan sulfate and chondroitin-6-sulfate in the connective tissue, the skeletal system, and the teeth.
• 5q11-q13 (Maroteaux-Lamy syndrome)
• Xq27.3-q28 (Hunter syndrome)

A new mutation has been reported, making a total of 15 different mutations that can cause premature stop codons in the alpha-L-iduronidase gene (IDUA), and the biochemistry of these mutations has been investigated. Natural stop codon read-through is dependent on the fidelity of the codon when evaluated at Q70X and W402X in CHO-K1 cells, but the 3 possible stop codons, TAA, TAG, and TGA, have different effects on mRNA stability, and this effect is context dependent.

In CHO-K1 cells expressing the Q70X and W402X mutations, the level of gentamicin-enhanced stop codon read-through is slightly less than the increment in activity caused by a lower-fidelity stop codon. In this system, gentamicin has more effect on read-through for the TAA and TGA stop codons compared with the TAG stop codon. In an MPS type I patient study, premature TGA stop codons were associated with a slightly attenuated clinical phenotype when compared with classic Hurler syndrome (eg, W402X/W402X and Q70X/Q70X genotypes with TAG stop codons). Natural read-through of premature stop codons is a potential explanation for the variable clinical phenotype in patients with MPS type I. Enhanced stop codon read-through is a potential treatment strategy for a large subgroup of patients with MPS type I.

In 25 Korean patients with Hunter syndrome, 20 mutations were identified, of which 13 mutations are novel: 6 small deletions (ie, 69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (ie, 21_22insG, 683_684insC), 2 terminations (ie, 529G>T, 637A>T), and 3 missense mutations (ie, 353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII restriction fragment length polymorphisms, 3 gene deletions were found. When the 20 mutations were depicted in a 3-dimensional model of iduronate 2 sulfatase protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas.

The candidate gene for MPS type IIIC has been localized to the pericentric region of chromosome 8 by linkage disequilibrium analysis.

Frequency

International

The prevalences are as follows: MPS type I-H, 1-2 cases per 100,000 population; MPS type I-S, 1 case per 250,000 population; MPS type II, 1 case per 100,000 population; MPS type III, 1 case per 25,000-75,000 population; and MPS type IV, 1 case per 40,000-200,000 population.

The prevalences of MPS types VI, VII, and I-H/S are unknown, but the prevalence of MPS type I-H/S approximates that of MPS type I-S.

According to the US National Institutes of Health, studies in Canada estimate 1 in 100,000 babies born has Hurler syndrome. The estimate for Hurler-Scheie syndrome is 1 in 115,000, and for Scheie syndrome, it is 1 in 500,000.

An epidemiologic study of the MPSs in Western Australia using multiple ascertainment sources was performed and the incidence rate for the period 1969-1996 was estimated. An incidence of approximately 1 case in 107,000 live births was obtained for MPS type I-H (Hurler phenotype); 1 case in 320,000 live births (1 in 165,000 male live births) for MPS type II (Hunter syndrome); 1 case in 58,000 for MPS III (Sanfilippo syndrome); 1 case in 640,000 for MPS type IV-A (Morquio syndrome type A); and 1 case in 320,000 for MPS type VI (Maroteaux-Lamy syndrome). The overall incidence for all types of MPS was approximately 1 case in 29,000 live births.

Mortality/Morbidity

Patients with Hurler syndrome usually die by age 5-10 years. The life expectancy of patients with Scheie syndrome may be nearly normal. They can live until the fifth or sixth decade of life, and they can have healthy offspring. As for patients with Hunter and Sanfilippo syndromes, death usually occurs by the time of puberty. In the classic form of Morquio syndrome, long-term survival is rare, with death occurring in persons aged 20-40 years. In patients with the severe form of Maroteaux-Lamy syndrome, death usually occurs by early adulthood.

Age

Onset usually occurs in early childhood.

Please click here to view the full topic text: Mucopolysaccharidoses Types I-VII