Sections

Sections Mucopolysaccharidoses Types I-VII
Overview
Presentation
DDx
Workup
Treatment
Medication
Media Gallery
Tables
References

Overview

Practice Essentials

Mucopolysaccharidoses (MPSs) are a group of lysosomal storage diseases, each of which is produced by an inherited deficiency of an enzyme involved in the degradation of acid mucopolysaccharides, now called glycosaminoglycans (GAGs). These diseases are autosomal recessive, except for mucopolysaccharidosis type II, which is X-linked. There are currently 13 identified MPSs, 2 of which were discovered in the 2020s.^[1]

In addition to the Medscape orthopedics article Mucopolysaccharidosis, the following are pediatrics articles on mucopolysaccharidoses:

Mucopolysaccharidosis Type I
Mucopolysaccharidosis Type II (Hunter syndrome)
Mucopolysaccharidosis Type III (Sanfilippo syndrome)
Mucopolysaccharidosis Type IV (Morquio syndrome, see images below)
Mucopolysaccharidosis Type VI (Maroteaux-Lamy syndrome)
Mucopolysaccharidosis Type VII (Sly syndrome)

An 8-year-old boy with Morquio syndrome and severe kyphoscoliosis. Courtesy of Dennis P. Grogan, MD.

View Media Gallery

A 7-year-old girl with Morquio syndrome and typical severe genu valgum. Courtesy of Dennis P. Grogan, MD.

View Media Gallery

Pathophysiology

GAGs are long, linear polysaccharide molecules composed of repeating dimers, each of which contains a hexuronic acid (or galactose in the case of keratan sulfate) and an amino sugar. The large proteoglycan molecules made up of protein cores, and GAG branches are secreted by cells and constitute a significant fraction of the extracellular matrix of connective tissue. The turnover of these molecules depends on their subsequent internalization by endocytosis, their delivery to the lysosomes, and their digestion by lysosomal enzymes. The enzyme deficiencies lead to the accumulation of mucopolysaccharides in the lysosomes of the cells in the connective tissue and to an increase in their excretion in the urine. The types of mucopolysaccharidoses linked to specific enzyme deficiencies are listed below; some have been assigned an Enzyme Commission (EC) number.

Table. Types of Mucopolysaccharidoses and Associated Enzyme Deficiencies (Open Table in a new window)

Mucopolysaccharidosis Type	Syndrome Name	Deficiency	EC Number
MPS type I-H	Hurler syndrome	Alpha-L-iduronidase	3.2.1.76
MPS type I-S (formerly MPS type V)	Scheie syndrome	Alpha-L-iduronidase	N/A
MPS type I-H/S	Hurler-Scheie syndrome	Alpha-L-iduronidase	N/A
MPS type II, mild	Hunter syndrome, mild form	L-sulfoiduronate sulfatase	N/A
MPS type II, severe	Hunter syndrome, severe form	L-sulfoiduronate sulfatase	3.1.6.13
MPS type III-A	Sanfilippo syndrome type A	Heparan sulfate sulfamidase	3.1.6.14
MPS type III-B	Sanfilippo syndrome type B	N -acetyl-alpha-D-glucosaminidase	3.2.1.50
MPS type III-C	Sanfilippo syndrome type C	Acetyl-coenzyme A (CoA): alpha-glucosamide N -acetyltransferase	2.3.1.3
MPS type III-D	Sanfilippo syndrome type D	N -acetyl-alpha-D-glucosamine-6-sulfatase	3.1.6.14
MPS type IV-A	Morquio syndrome, classic form	N -acetylgalactosamine-6-sulfatase (gal-6-sulfatase)	3.1.6.4
MPS type IV-B	Morquiolike syndrome	Beta-galactosidase	3.2.1.23
MPS type VI	Maroteaux-Lamy syndrome, mild form	N -acetylgalactosamine-4-sulfatase (arylsulfatase B)	N/A
MPS type VI	Maroteaux-Lamy syndrome, severe form	N -acetylgalactosamine-4-sulfatase (arylsulfatase B)	3.1.6.1
MPS type VII	Sly syndrome	Beta-glucuronidase	3.2.1.31

The enzyme synthesis is controlled at the following gene loci:

4p16.3 (Hurler syndrome, Scheie syndrome): The activity of alpha-L-iduronidase is decreased in Hurler syndrome and Scheie syndrome. However, Hurler syndrome is a severe form of the same heavy mucopolysaccharidosis, with affected children dying after several years, whereas Scheie disease has a mild clinical phenotype. In some populations, premature stop mutations represent roughly two thirds of the mutations that cause Hurler syndrome.
12q14 (Sanfilippo syndrome): The diagnosis requires a specific lysosomal enzyme assay for glucosamine (N -acetyl)-6-sulfatase (GNS) activity. A homozygous nonsense mutation is found in exon 9 (1063C --> T), which predicts premature termination of translation (R355X). In addition, 2 common synonymous coding single-nucleotide polymorphisms are found and genotyped in samples from 4 ethnic groups.
16q24.3 (Morquio syndrome): The deficiency of enzymes in Morquio syndrome type A or type B leads to the accumulation of keratan sulfate and chondroitin-6-sulfate in the connective tissue, the skeletal system, and the teeth.
5q11-q13 (Maroteaux-Lamy syndrome)
Xq27.3-q28 (Hunter syndrome)

A new mutation has been reported, making a total of 15 different mutations that can cause premature stop codons in the alpha-L-iduronidase gene (IDUA), and the biochemistry of these mutations has been investigated. Natural stop codon read-through is dependent on the fidelity of the codon when evaluated at Q70X and W402X in CHO-K1 cells, but the 3 possible stop codons, TAA, TAG, and TGA, have different effects on mRNA stability, and this effect is context dependent.

In CHO-K1 cells expressing the Q70X and W402X mutations, the level of gentamicin-enhanced stop codon read-through is slightly less than the increment in activity caused by a lower-fidelity stop codon. In this system, gentamicin has more effect on read-through for the TAA and TGA stop codons compared with the TAG stop codon. In a mucopolysaccharidosis type I patient study, premature TGA stop codons were associated with a slightly attenuated clinical phenotype when compared with classic Hurler syndrome (eg, W402X/W402X and Q70X/Q70X genotypes with TAG stop codons). Natural read-through of premature stop codons is a potential explanation for the variable clinical phenotype in patients with mucopolysaccharidosis type I. Enhanced stop codon read-through is a potential treatment strategy for a large subgroup of patients with mucopolysaccharidosis type I.

In 25 Korean patients with Hunter syndrome, 20 mutations were identified, of which 13 mutations are novel: 6 small deletions (ie, 69_88delCCTCGGATCCGAAACGCAGG, 121-123delCTC, 500delA, 877_878delCA, 787delG, 1042_1049delTACAGCAA), 2 insertions (ie, 21_22insG, 683_684insC), 2 terminations (ie, 529G>T, 637A>T), and 3 missense mutations (ie, 353C>A, 779T>C, 899G>T). Moreover, using TaqI or HindIII restriction fragment length polymorphisms, 3 gene deletions were found. When the 20 mutations were depicted in a 3-dimensional model of iduronate 2 sulfatase protein, most of the mutations were found to be at structurally critical points that could interfere with refolding of the protein, although they were located in peripheral areas.

The candidate gene for mucopolysaccharidosis type IIIC has been localized to the pericentric region of chromosome 8 by linkage disequilibrium analysis.

Hamano et al^[2]immunohistochemically examined the involvement of tauopathy/synucleinopathy, cell death, and oxidative damage in the brains of 3 cases each of mucopolysaccharidosis IIIB and mucopolysaccharidosis II and age-matched controls. In cases of mucopolysaccharidosis IIIB, the density of GABAergic interneurons in the cerebral cortex immunoreactive for calbindin-D28K and parvalbumin was markedly reduced compared with age-matched controls. The swollen neurons showed immunoreactivity for phosphorylated alpha-synuclein but not for phosphorylated tau protein or beta-amyloid protein; those in the cerebral cortex demonstrated nuclear immunoreactivity for TUNEL, single-stranded DNA and 8-OHdG. Neither lipid peroxidation nor protein glycation was marked in mucopolysaccharidosis cases. The expression levels of superoxide dismutases (Cu/ZnSOD and MnSOD) and glial glutamate transporters (EAAT1 and EAAT2) were reduced in 2 mucopolysaccharidosis II cases.

The disturbance of GABAergic interneurons can be related to mental disturbance, while synucleinopathy and/or DNA impairment may be implicated in the neurodegeneration of swelling neurons, owing to storage materials in mucopolysaccharidosis IIIB cases. These findings suggest the possibility of neuroprotective therapies other than enzyme replacement in mucopolysaccharidosis patients.^[2]

The transmembrane protein gene TMEM76, which encodes a 73-kd protein with predicted multiple transmembrane domains and glycosylation sites, was found. Northern blot analysis identified 2 major TMEM76 transcripts of 4.5 kb and 2.1 kb ubiquitously expressed in various human tissues. The highest expression was detected in leukocytes and in heart, lung, placenta, and liver cells, whereas the gene was expressed at a much lower level in the thymus, colon, and brain, which is consistent with the expression patterns of lysosomal proteins. A total of 27 TMEM76 mutations were identified in the DNA of 30 mucopolysaccharidosis IIIC–affected families, which were not found in DNA from 105 controls.^[3]

Functional expression of human TMEM76 and the mouse orthologue demonstrates that this gene encodes the lysosomal GNAT. Furthermore, it suggests that this enzyme belongs to a new structural class of proteins that transport the activated acetyl residues across the cell membrane.^[3]

Oxidative stress may be involved in the pathophysiology of mucopolysaccharidosis type IV-A. A study of Donida et al describes an increase in oxidative damage to biomolecules (lipids, urine isoprostanes; proteins, urine di-Tyr and plasma sulfhydryl groups) and significant increases in basal DNA damage in mucopolysaccharidosis type IV-A patients.^[4]

Frequency

The prevalences are as follows: mucopolysaccharidosis type I-H, 1-2 cases per 100,000 population; mucopolysaccharidosis type I-S, 1 case per 250,000 population; mucopolysaccharidosis type II, 1 case per 100,000 population; mucopolysaccharidosis type III, 1 case per 25,000-75,000 population; and mucopolysaccharidosis type IV, 1 case per 40,000-200,000 population.

The prevalences of mucopolysaccharidosis types VI, VII, and I-H/S are unknown, but the prevalence of mucopolysaccharidosis type I-H/S approximates that of mucopolysaccharidosis type I-S.

According to the US National Institutes of Health, studies in Canada estimate 1 in 100,000 babies born has Hurler syndrome. The estimate for Hurler-Scheie syndrome is 1 in 115,000, and for Scheie syndrome, it is 1 in 500,000.

An epidemiologic study of the mucopolysaccharidoses in Western Australia using multiple ascertainment sources was performed and the incidence rate for the period 1969-1996 was estimated. An incidence of approximately 1 case in 107,000 live births was obtained for mucopolysaccharidosis type I-H (Hurler phenotype); 1 case in 320,000 live births (1 in 165,000 male live births) for mucopolysaccharidosis type II (Hunter syndrome); 1 case in 58,000 for mucopolysaccharidosis III (Sanfilippo syndrome); 1 case in 640,000 for mucopolysaccharidosis type IV-A (Morquio syndrome type A); and 1 case in 320,000 for mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome). The overall incidence for all types of mucopolysaccharidosis was approximately 1 case in 29,000 live births.

Murphy et al estimated the incidence (2001-2006) and prevalence (2002 census) of mucopolysaccharidosis type I in the Irish Republic (AOl) using population data. The birth incidence was 1 case in 26,206 births, with a carrier frequency of 1 case in 81 births. Of note, 19 (73%) of 26 Hurler syndrome patients were Irish Travelers. Amongst Irish Travelers, the incidence was 1 case in 371 persons, with a carrier frequency of 1 case in 10 persons. This is the highest recorded incidence worldwide.^[5]

According to the incidence study covered the period from 1975-2004 in Sweden and Denmark and from 1979-2004 in Norway, the incidence of all mucopolysaccharidosis disorders was 1.75 cases in Sweden, 3.08 cases in Norway, and 1.77 cases in Denmark per 100 000 newborns. The incidence of mucopolysaccharidosis type I was the most common in all 3 countries, with 0.67, 1.85, and 0.54 cases per 100 000 newborns, respectively; for mucopolysaccharidosis type II, numbers were 0.27, 0.13, and 0.27 cases, respectively. For patients with other mucopolysaccharidosis disorders, the incidence varied widely. The prevalence for all mucopolysaccharidosis disorders was 4.24, 7.06, and 6.03 cases per million inhabitants in Sweden, Norway, and Denmark, respectively.^[6]

Héron et al in the retrospective epidemiological study in France, the United Kingdom, and Greece calculated the incidence according to the number of patients born each year and then diagnosed with mucopolysaccharidosis type III before 2006. A comparison between countries focused on years 1990-1994. The calculated incidence of mucopolysaccharidosis type III in France (0.68 case per 100,000 live-births) was almost half that in the United Kingdom (1.15 cases per 100,000). Prevalence in Greece (0.97 case per 100,000 live-births) was in between France and the United Kingdom. However, mucopolysaccharidosis type IIIA was not diagnosed in Greece, and mucopolysaccharidosis type IIIB was the most highly prevalent type.^[7]

Age

Onset usually occurs in early childhood.

Prognosis

Patients with Hurler syndrome usually die by age 5-10 years. The life expectancy of patients with Scheie syndrome may be nearly normal. They can live until the fifth or sixth decade of life, and they can have healthy offspring. As for patients with Hunter and Sanfilippo syndromes, death usually occurs by the time of puberty. In the classic form of Morquio syndrome, long-term survival is rare, with death occurring in persons aged 20-40 years. In patients with the severe form of Maroteaux-Lamy syndrome, death usually occurs by early adulthood.

Mucopolysaccharidosis type I (Hurler syndrome)

Patients with Hurler syndrome have a poor prognosis. Children with this disease have significant progressive physical and mental deficiencies. Death can occur in late childhood, early adolescence, or adulthood.

Mucopolysaccharidosis type II (Hunter syndrome)

The life expectancy for the early-onset form (severe form) is 10-20 years; for the late-onset form (mild form), it is 20-60 years.

Mucopolysaccharidosis type III (Sanfilippo syndrome)

Severe intellectual disability is the most important of the clinical problems. Patients may have IQs below 50. Severe cases lead to death before the patient is aged 20 years. In a minority of cases, it is compatible with a normal lifespan.

Mucopolysaccharidosis type IV (Morquio syndrome)

Bony abnormalities represent a significant problem. Small vertebrae at the top of the neck can cause slippage that damages the spinal cord, possibly resulting in paralysis. Death may occur as a result of cardiac complications.

Mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome)

The life expectancy is the second to third decade of life, with patients dying from heart failure. Patients may die earlier from cardiac or neurologic complications, depending on the severity of disease.

Mucopolysaccharidosis type VII (Sly syndrome)

In mild cases, patients were reported to survive to age 19-20 years. Life expectancy is reduced as a result of frequent upper respiratory tract infections, neurodegenerative complications, and gastrointestinal tract abnormalities.

Clinical Presentation

Węgrzyn G, Pierzynowska K, Pavone LM. Editorial: Molecular Aspects of Mucopolysaccharidoses. Front Mol Biosci. 2022. 9:874267. [QxMD MEDLINE Link]. [Full Text].
Hamano K, Hayashi M, Shioda K, Fukatsu R, Mizutani S. Mechanisms of neurodegeneration in mucopolysaccharidoses II and IIIB: analysis of human brain tissue. Acta Neuropathol. 2008 May. 115(5):547-59. [QxMD MEDLINE Link].
Hrebicek M, Mrazova L, Seyrantepe V, et al. Mutations in TMEM76* cause mucopolysaccharidosis IIIC (Sanfilippo C syndrome). Am J Hum Genet. 2006 Nov. 79(5):807-19. [QxMD MEDLINE Link].
Donida B, Marchetti DP, Biancini GB, et al. Oxidative stress and inflammation in mucopolysaccharidosis type IVA patients treated with enzyme replacement therapy. Biochim Biophys Acta. 2015 May. 1852(5):1012-9. [QxMD MEDLINE Link].
Murphy AM, Lambert D, Treacy EP, O'Meara A, Lynch SA. Incidence and prevalence of mucopolysaccharidosis type 1 in the Irish republic. Arch Dis Child. 2009 Jan. 94(1):52-4. [QxMD MEDLINE Link].
Malm G, Lund AM, Mansson JE, Heiberg A. Mucopolysaccharidoses in the Scandinavian countries: incidence and prevalence. Acta Paediatr. 2008 Nov. 97(11):1577-81. [QxMD MEDLINE Link].
Héron B, Mikaeloff Y, Froissart R, et al. Incidence and natural history of mucopolysaccharidosis type III in France and comparison with United Kingdom and Greece. Am J Med Genet A. 2011 Jan. 155A(1):58-68. [QxMD MEDLINE Link].
Keilmann A, Läßig AK, Pollak-Hainz A, Mann WJ, Beck M, Hainz M. Adenoids of patients with mucopolysaccharidoses demonstrate typical alterations. Int J Pediatr Otorhinolaryngol. 2015 Feb. 79:115-8. [QxMD MEDLINE Link].
Nakarat T, Läßig AK, Lampe C, Keilmann A. Alterations in speech and voice in patients with mucopolysaccharidoses. Logoped Phoniatr Vocol. 2014 Apr. 39(1):30-7. [QxMD MEDLINE Link].
Perenc L. Anthropometric characteristics of four Polish children with mucopolysaccharidosis. BMC Research Notes. 2013. 6:246. [Full Text].
Miller BS, Fung EB, Kaizer A, et al. Longitudinal changes in linear growth and BMI in the mucopolysaccharidoses. Molecular Genetics and Metabolism. 2016 Feb. 117(2):S80-S81. [Full Text].
Ashrafi MR, Shabanian R, Mohammadi M, Kavusi S. Extensive Mongolian spots: a clinical sign merits special attention. Pediatr Neurol. 2006 Feb. 34(2):143-5. [QxMD MEDLINE Link].
Panteliadis CP, Karatza ED, Tzitiridou MK, Koliouskas DE, Spiroglou KS. Lissencephaly and mongolian spots in Hurler syndrome. Pediatr Neurol. 2003 Jul. 29(1):59-62. [QxMD MEDLINE Link].
Nemes A, Timmermans RG, Wilson JH, et al. The mild form of mucopolysaccharidosis type I (Scheie syndrome) is associated with increased ascending aortic stiffness. Heart Vessels. 2008 Mar. 23(2):108-11. [QxMD MEDLINE Link].
Demitsu T, Kakurai M, Okubo Y, et al. Skin eruption as the presenting sign of Hunter syndrome IIB. Clin Exp Dermatol. 1999 May. 24(3):179-82. [QxMD MEDLINE Link].
Sapadin AN, Friedman IS. Extensive Mongolian spots associated with Hunter syndrome. J Am Acad Dermatol. 1998 Dec. 39(6):1013-5. [QxMD MEDLINE Link].
Ochiai T, Suzuki Y, Kato T, et al. Natural history of extensive Mongolian spots in mucopolysaccharidosis type II (Hunter syndrome): a survey among 52 Japanese patients. J Eur Acad Dermatol Venereol. 2007 Sep. 21(8):1082-5. [QxMD MEDLINE Link].
Schwartz I, Vedolin L, Jardim LB, et al. Brain magnetic resonance imaging and spectroscopic findings inmucopolysaccharidosis type II. Acta Paediatrica. 2007. 96:109-11.
Kwon JY, Ko K, Sohn YB, et al. High prevalence of carpal tunnel syndrome in children with mucopolysaccharidosis type II (Hunter syndrome). Am J Med Genet A. 2011 Jun. 155A(6):1329-35. [QxMD MEDLINE Link].
Dodsworth Ch, Burton B K,. Increased incidence of neonatal respiratory distress in infants withmucopolysaccharidosis type II (MPS II, Hunter syndrome). Molecular Genetics and Metabolism. 2013. [Full Text].
Wijburg FA, Wegrzyn G, Burton BK, Tylki-Szymanska A. Mucopolysaccharidosis type III (Sanfilippo syndrome) and misdiagnosis of idiopathic developmental delay, attention deficit/hyperactivity disorder or autism spectrum disorder. Acta Paediatr. 2013 May. 102(5):462-70. [QxMD MEDLINE Link]. [Full Text].
Meyer A, Kossow K, Gal A, et al. Scoring evaluation of the natural course of mucopolysaccharidosis type IIIA (Sanfilippo syndrome type A). Pediatrics. 2007 Nov. 120(5):e1255-61. [QxMD MEDLINE Link].
Valayannopoulos V, Nicely H, Harmatz P, Turbeville S. Mucopolysaccharidosis VI. Orphanet J Rare Dis. 2010 Apr 12. 5:5. [QxMD MEDLINE Link]. [Full Text].
Alpoz AR, Coker M, Celen E, et al. The oral manifestations of Maroteaux-Lamy syndrome (mucopolysaccharidosis VI): a case report. Oral Surg Oral Med Oral Pathol Oral Radiol Endod. 2006 May. 101(5):632-7. [QxMD MEDLINE Link].
Oudit GY, Butany J, Williams WG, Siu SC, Clarke JT, Iwanochko RM. Left ventricular aneurysm in a patient with mucopolysaccharidosis type VI (Maroteaux-Lamy syndrome): clinical and pathological correlation. Cardiovasc Pathol. 2007 Jul-Aug. 16(4):237-40. [QxMD MEDLINE Link].
Okamura K, Munkhbat B, Batchimeg B, Tamiya G, Hozumi Y, Suzuki T. Case of a Mongolian child with extensive Mongolian spots in mucopolysaccharidosis type VI: identification of a novel mutation in the arylsulfatase B gene. J Dermatol. 2013 Sep. 40(9):758-9. [QxMD MEDLINE Link].
Ashrafi MR, Tavasoli A, Shiva S, Parvaneh N, Tamizifar B. Diffuse dermal melanocytosis in two patients with Sandhoff disease and mucopolysaccharidosis VI. Int J Dermatol. 2013 Oct 18. [QxMD MEDLINE Link].
Dickerman RD, Colle KO, Bruno CA Jr, Schneider SJ. Craniovertebral instability with spinal cord compression in a 17-month-old boy with Sly syndrome (mucopolysaccharidosis type VII): a surgical dilemma. Spine. 2004 Mar 1. 29(5):E92-4. [QxMD MEDLINE Link].
Venkat-Raman N, Sebire NJ, Murphy KW. Recurrent fetal hydrops due to mucopolysaccharidoses type VII. Fetal Diagn Ther. 2006. 21(3):250-4. [QxMD MEDLINE Link].
Delbecque K, Gaillez S, Schaaps JP. Histopathological diagnosis of a type vii mucopolysaccharidosis after pregnancy termination. Fetal Pediatr Pathol. 2009. 28(1):1-8. [QxMD MEDLINE Link].
Ashworth JL, Kruse FE, Bachmann B, et al. Ocular manifestations in the mucopolysaccharidoses – a review. Clin Exp Ophthalmol. 2010. 38:12–22.
Lin HY, Chuang CK, Chen MR, et al. Cardiac structure and function and effects of enzyme replacement therapy in patients with mucopolysaccharidoses I, II, IVA and VI. Mol Genet Metab. 2016 Apr. 117(4):431-7. [QxMD MEDLINE Link].
Gniadek TJ, Singer N, Barker NJ, et el. Cardiovascular pathologies in mucopolysaccharidosis type VII (Sly Syndrome). Cardiovasc Pathol. 2015 Sept-Oct. 24(5):322-6. [QxMD MEDLINE Link].
Leone A, Rigante D, Amato DZ, et al. Spinal involvement in mucopolysaccharidoses: a review. Childs Nerv Syst. 2015 Feb. 31(2):203-12. [QxMD MEDLINE Link].
Gallegos-Arreola MP, Machorro-Lazo MV, Flores-Martinez SE, et al. Urinary glycosaminoglycan excretion in healthy subjects and in patients with mucopolysaccharidoses. Arch Med Res. 2000 Sep-Oct. 31(5):505-10. [QxMD MEDLINE Link].
Dean CJ, Bockmann MR, Hopwood JJ, Brooks DA, Meikle PJ. Detection of mucopolysaccharidosis type II by measurement of iduronate-2-sulfatase in dried blood spots and plasma samples. Clin Chem. 2006 Apr. 52(4):643-9. [QxMD MEDLINE Link].
Di Natale P, Villani GR, Parini R, et al. Molecular markers for the follow-up of enzyme-replacement therapy in mucopolysaccharidosis type VI disease. Biotechnol Appl Biochem. 2008 Mar. 49:219-23. [QxMD MEDLINE Link].
Blanchard S, Sadilek M, Scott CR, Turecek F, Gelb MH. Tandem mass spectrometry for the direct assay of lysosomal enzymes in dried blood spots: application to screening newborns for mucopolysaccharidosis I. Clin Chem. 2008 Dec. 54(12):2067-70. [QxMD MEDLINE Link].
Randall DR, Colobong KE, Hemmelgarn H, et al. Heparin cofactor II-thrombin complex: a biomarker of MPS disease. Mol Genet Metab. 2008 Aug. 94(4):456-61. [QxMD MEDLINE Link].
Dung VC, Tomatsu S, Montaño AM, et al. Mucopolysaccharidosis IVA: correlation between genotype, phenotype and keratan sulfate levels. Mol Genet Metab. 2013 Sep-Oct. 110(1-2):129-38. [QxMD MEDLINE Link]. [Full Text].
de Santana Sarmento DJ, de Carvalho SH, Melo SL, et al. Mucopolysaccharidosis: radiographic findings in a series of 16 cases. Oral Surg Oral Med Oral Pathol Oral Radiol. 2015 Dec. 120(6):e240-6. [QxMD MEDLINE Link].
Gabrielli O, Polonara G, Regnicolo L, et al. Correlation between cerebral MRI abnormalities and mental retardation in patients with mucopolysaccharidoses. Am J Med Genet A. 2004 Mar 15. 125A(3):224-31. [QxMD MEDLINE Link].
Matheus MG, Castillo M, Smith JK, Armao D, Towle D, Muenzer J. Brain MRI findings in patients with mucopolysaccharidosis types I and II and mild clinical presentation. Neuroradiology. 2004 Aug. 46(8):666-72. [QxMD MEDLINE Link].
Palmucci S, Attinà G, Lanza ML, et al. Imaging findings of mucopolysaccharidoses: a pictorial review. Insights Imaging. 2013 Aug. 4(4):443-59. [QxMD MEDLINE Link]. [Full Text].
Husain AM, Escolar ML, Kurtzberg J. Neurophysiologic assessment of mucopolysaccharidosis III. Clin Neurophysiol. 2006 Sep. 117(9):2059-63. [QxMD MEDLINE Link].
Cimaz R, Vijay S, Haase C, et al. Attenuated type I mucopolysaccharidosis in the differential diagnosis of juvenile idiopathic arthritis: a series of 13 patients with Scheie syndrome. Clin Exp Rheumatol. 2006 Mar-Apr. 24(2):196-202. [QxMD MEDLINE Link].
Anawis MA. Hunter syndrome (MPS II-B): a report of bilateral vitreous floaters and maculopathy. Ophthalmic Genet. 2006 Jun. 27(2):71-2. [QxMD MEDLINE Link].
Braunlin EA, Berry JM, Whitley CB. Cardiac findings after enzyme replacement therapy for mucopolysaccharidosis type I. Am J Cardiol. 2006 Aug 1. 98(3):416-8. [QxMD MEDLINE Link].
Gassas A, Sung L, Doyle JJ, Clarke JT, Saunders EF. Life-threatening pulmonary hemorrhages post bone marrow transplantation in Hurler syndrome. Report of three cases and review of the literature. Bone Marrow Transplant. 2003 Jul. 32(2):213-5. [QxMD MEDLINE Link].
Grewal SS, Krivit W, Defor TE, et al. Outcome of second hematopoietic cell transplantation in Hurler syndrome. Bone Marrow Transplant. 2002 Mar. 29(6):491-6. [QxMD MEDLINE Link].
Yasuda E, Mackenzie W, Ruhnke K, et al. Long-term follow-up of post hematopoietic stem cell transplantation for Hurler syndrome: Clinical, biochemical, and pathological improvements. Mol Genet Metab Rep. 2015 Mar. 2:65-76. [QxMD MEDLINE Link].
Harmatz P, Whitley CB, Waber L, et al. Enzyme replacement therapy in mucopolysaccharidosis VI (Maroteaux-Lamy syndrome). J Pediatr. 2004 May. 144(5):574-80. [QxMD MEDLINE Link].
Kloska A, Jakóbkiewicz-Banecka J, Narajczyk M, Banecka-Majkutewicz Z, Wegrzyn G. Effects of flavonoids on glycosaminoglycan synthesis: implications for substrate reduction therapy in Sanfilippo disease and other mucopolysaccharidoses. Metab Brain Dis. 2011 Mar. 26(1):1-8. [QxMD MEDLINE Link]. [Full Text].
Muenzer J, Wraith JE, Beck M, et al. A phase II/III clinical study of enzyme replacement therapy with idursulfase in mucopolysaccharidosis II (Hunter syndrome). Genet Med. 2006 Aug. 8(8):465-73. [QxMD MEDLINE Link].
Wraith JE, Clarke LA, Beck M, et al. Enzyme replacement therapy for mucopolysaccharidosis I: a randomized, double-blinded, placebo-controlled, multinational study of recombinant human alpha-L-iduronidase (laronidase). J Pediatr. 2004 May. 144(5):581-8. [QxMD MEDLINE Link].
Muenzer J, Wraith JE, Clarke LA. Mucopolysaccharidosis I: management and treatment guidelines. Pediatrics. 2009 Jan. 123(1):19-29. [QxMD MEDLINE Link].
A Double-Blind Study to Evaluate the Efficacy and Safety of BMN 110 in Patients With Mucopolysaccharidosis IVA (Morquio A Syndrome). NCT01275066. ClinicalTrials.gov. Available at http://clinicaltrials.gov/ct2/show/study/NCT01275066. Accessed: February 20, 2014.
Harmatz P, Giugliani R, Schwartz I, et al. Enzyme replacement therapy for mucopolysaccharidosis VI: a phase 3, randomized, double-blind, placebo-controlled, multinational study of recombinant human N-acetylgalactosamine 4-sulfatase (recombinant human arylsulfatase B or rhASB) and follow-on, open-label extension study. J Pediatr. 2006 Apr. 148(4):533-539. [QxMD MEDLINE Link].
Noh H, Lee JI. Current and potential therapeutic strategies for mucopolysaccharidoses. J Clin Pharm Ther. 2014 jun. 39(3):215-24. [QxMD MEDLINE Link].
Frawley D, Fuenzalida D, Donath S, Yaplito-Lee J, Peters H. A retrospective audit of anesthetic techniques and complications in children with mucopolysaccharidoses. Pediatric Anesthesia. 2012. 22:737– 744.
Altarescu G, Renbaum P, Eldar-Geva T, et al. Preventing mucopolysaccharidosis type II (Hunter syndrome): PGD and establishing a Hunter (46, XX) stem cell line. Prenat Diagn. 2011 Jun 27. [QxMD MEDLINE Link].
Tylki-Szymańska A, Almássy Z, Christophidou-Anastasiadou V, et al. The landscape of Mucopolysaccharidosis in Southern and Eastern European countries: a survey from 19 specialistic centers. Orphanet J Rare Dis. 2022 Mar 24. 17 (1):136. [QxMD MEDLINE Link]. [Full Text].
Hein LK, Bawden M, Muller VJ, Sillence D, Hopwood JJ, Brooks DA. alpha-L-iduronidase premature stop codons and potential read-through in mucopolysaccharidosis type I patients. J Mol Biol. 2004 Apr 30. 338(3):453-62. [QxMD MEDLINE Link].
Caillaud C, Poenaru L. Gene therapy in lysosomal diseases. Biomed Pharmacother. 2000 Oct. 54(10):505-12. [QxMD MEDLINE Link].
Fu H, Samulski RJ, McCown TJ, Picornell YJ, Fletcher D, Muenzer J. Neurological correction of lysosomal storage in a mucopolysaccharidosis IIIB mouse model by adeno-associated virus-mediated gene delivery. Mol Ther. 2002 Jan. 5(1):42-9. [QxMD MEDLINE Link].
Gosele S, Dithmar S, Holz FG, Volcker HE. [Late diagnosis of Morquio syndrome. Clinical histopathological findings in a rare mucopolysaccharidosis]. Klin Monatsbl Augenheilkd. 2000 Aug. 217(2):114-7. [QxMD MEDLINE Link].
Ito K, Ochiai T, Suzuki H, Chin M, Shichino H, Mugishima H. The effect of haematopoietic stem cell transplant on papules with 'pebbly' appearance in Hunter's syndrome. Br J Dermatol. 2004 Jul. 151(1):207-11. [QxMD MEDLINE Link].
Jeong HS, Cho DY, Ahn KM, Jin DK. Complications of tracheotomy in patients with mucopolysaccharidoses type II (Hunter syndrome). Int J Pediatr Otorhinolaryngol. 2006 Oct. 70(10):1765-9. [QxMD MEDLINE Link].
Kakavanos R, Turner CT, Hopwood JJ, Kakkis ED, Brooks DA. Immune tolerance after long-term enzyme-replacement therapy among patients who have mucopolysaccharidosis I. Lancet. 2003 May 10. 361(9369):1608-13. [QxMD MEDLINE Link].
Kakkis ED, Muenzer J, Tiller GE, et al. Enzyme-replacement therapy in mucopolysaccharidosis I. N Engl J Med. 2001 Jan 18. 344(3):182-8. [QxMD MEDLINE Link].
Keeling KM, Brooks DA, Hopwood JJ, Li P, Thompson JN, Bedwell DM. Gentamicin-mediated suppression of Hurler syndrome stop mutations restores a low level of alpha-L-iduronidase activity and reduces lysosomal glycosaminoglycan accumulation. Hum Mol Genet. 2001 Feb 1. 10(3):291-9. [QxMD MEDLINE Link].
Kim CH, Hwang HZ, Song SM, et al. Mutational spectrum of the iduronate 2 sulfatase gene in 25 unrelated Korean Hunter syndrome patients: identification of 13 novel mutations. Hum Mutat. 2003 Apr. 21(4):449-50. [QxMD MEDLINE Link].
Krivit W. Allogeneic stem cell transplantation for the treatment of lysosomal and peroxisomal metabolic diseases. Springer Semin Immunopathol. 2004 Nov. 26(1-2):119-32. [QxMD MEDLINE Link].
Lee V, Li CK, Shing MM, et al. Umbilical cord blood transplantation for Maroteaux-Lamy syndrome (mucopolysaccharidosis type VI). Bone Marrow Transplant. 2000 Aug. 26(4):455-8. [QxMD MEDLINE Link].
Leighton SE, Papsin B, Vellodi A, Dinwiddie R, Lane R. Disordered breathing during sleep in patients with mucopolysaccharidoses. Int J Pediatr Otorhinolaryngol. 2001 Apr 27. 58(2):127-38. [QxMD MEDLINE Link].
Mahalingam K, Janani S, Priya S, Elango EM, Sundari RM. Diagnosis of mucopolysaccharidoses: how to avoid false positives and false negatives. Indian J Pediatr. 2004 Jan. 71(1):29-32. [QxMD MEDLINE Link].
Mariotti P, Della Marca G, Iuvone L, et al. Sleep disorders in Sanfilippo syndrome: a polygraphic study. Clin Electroencephalogr. 2003 Jan. 34(1):18-22. [QxMD MEDLINE Link].
Mok A, Cao H, Hegele RA. Genomic basis of mucopolysaccharidosis type IIID (MIM 252940) revealed by sequencing of GNS encoding N-acetylglucosamine-6-sulfatase. Genomics. 2003 Jan. 81(1):1-5. [QxMD MEDLINE Link].
Nelson J, Crowhurst J, Carey B, Greed L. Incidence of the mucopolysaccharidoses in Western Australia. Am J Med Genet A. 2003 Dec 15. 123A(3):310-3. [QxMD MEDLINE Link].
Prystowsky SD, Maumenee IH, Freeman RG, Herndon JH Jr, Harrod MJ. A cutaneous marker in the Hunter syndrome a report of four cases. Arch Dermatol. 1977 May. 113(5):602-5. [QxMD MEDLINE Link].
Punnett A, Bliss B, Dupuis LL, Abdolell M, Doyle J, Sung L. Ototoxicity following pediatric hematopoietic stem cell transplantation: a prospective cohort study. Pediatr Blood Cancer. 2004 Jun. 42(7):598-603. [QxMD MEDLINE Link].
Rigante D, Caradonna P. Secondary skeletal involvement in Sanfilippo syndrome. QJM. 2004 Apr. 97(4):205-9. [QxMD MEDLINE Link].
Ross CJ, Bastedo L, Maier SA, Sands MS, Chang PL. Treatment of a lysosomal storage disease, mucopolysaccharidosis VII, with microencapsulated recombinant cells. Hum Gene Ther. 2000 Oct 10. 11(15):2117-27. [QxMD MEDLINE Link].
Sands MS, Barker JE, Vogler C, et al. Treatment of murine mucopolysaccharidosis type VII by syngeneic bone marrow transplantation in neonates. Lab Invest. 1993 Jun. 68(6):676-86. [QxMD MEDLINE Link].
Schiro JA, Mallory SB, Demmer L, Dowton SB, Luke MC. Grouped papules in Hurler-Scheie syndrome. J Am Acad Dermatol. 1996 Nov. 35(5 Pt 2):868-70. [QxMD MEDLINE Link].
Scriver RC, Beaudet AL, Sly WS. The Metabolic and Molecular Bases of Inherited Disease. New York, NY: McGraw-Hill; 1995.
Seyrantepe V, Tihy F, Pshezhetsky AV. The microcell-mediated transfer of human chromosome 8 restores the deficient N-acetylytransferase activity in skin fibroblasts of Mucopolysaccharidosis type IIIC patients. Hum Genet. 2006 Sep. 120(2):293-6. [QxMD MEDLINE Link].
Shinhar SY, Zablocki H, Madgy DN. Airway management in mucopolysaccharide storage disorders. Arch Otolaryngol Head Neck Surg. 2004 Feb. 130(2):233-7. [QxMD MEDLINE Link].
Weisstein JS, Delgado E, Steinbach LS, Hart K, Packman S. Musculoskeletal manifestations of Hurler syndrome: long-term follow-up after bone marrow transplantation. J Pediatr Orthop. 2004 Jan-Feb. 24(1):97-101. [QxMD MEDLINE Link].
Whitley CB, Belani KG, Chang PN, et al. Long-term outcome of Hurler syndrome following bone marrow transplantation. Am J Med Genet. 1993 Apr 15. 46(2):209-18. [QxMD MEDLINE Link].
Wolanczyk T, Banaszkiewicz A, Mierzewska H, Czartoryska B, Zdziennicka E. [Hyperactivity and behavioral disorders in Sanfilippo A (mucopolysaccharidosis type IIIA)--case report and review of the literature]. Psychiatr Pol. 2000 Sep-Oct. 34(5):831-7. [QxMD MEDLINE Link].

Media Gallery

An 8-year-old boy with Morquio syndrome and severe kyphoscoliosis. Courtesy of Dennis P. Grogan, MD.
A 7-year-old girl with Morquio syndrome and typical severe genu valgum. Courtesy of Dennis P. Grogan, MD.

of 2

Table. Types of Mucopolysaccharidoses and Associated Enzyme Deficiencies

Table. Types of Mucopolysaccharidoses and Associated Enzyme Deficiencies

Mucopolysaccharidosis Type	Syndrome Name	Deficiency	EC Number
MPS type I-H	Hurler syndrome	Alpha-L-iduronidase	3.2.1.76
MPS type I-S (formerly MPS type V)	Scheie syndrome	Alpha-L-iduronidase	N/A
MPS type I-H/S	Hurler-Scheie syndrome	Alpha-L-iduronidase	N/A
MPS type II, mild	Hunter syndrome, mild form	L-sulfoiduronate sulfatase	N/A
MPS type II, severe	Hunter syndrome, severe form	L-sulfoiduronate sulfatase	3.1.6.13
MPS type III-A	Sanfilippo syndrome type A	Heparan sulfate sulfamidase	3.1.6.14
MPS type III-B	Sanfilippo syndrome type B	N -acetyl-alpha-D-glucosaminidase	3.2.1.50
MPS type III-C	Sanfilippo syndrome type C	Acetyl-coenzyme A (CoA): alpha-glucosamide N -acetyltransferase	2.3.1.3
MPS type III-D	Sanfilippo syndrome type D	N -acetyl-alpha-D-glucosamine-6-sulfatase	3.1.6.14
MPS type IV-A	Morquio syndrome, classic form	N -acetylgalactosamine-6-sulfatase (gal-6-sulfatase)	3.1.6.4
MPS type IV-B	Morquiolike syndrome	Beta-galactosidase	3.2.1.23
MPS type VI	Maroteaux-Lamy syndrome, mild form	N -acetylgalactosamine-4-sulfatase (arylsulfatase B)	N/A
MPS type VI	Maroteaux-Lamy syndrome, severe form	N -acetylgalactosamine-4-sulfatase (arylsulfatase B)	3.1.6.1
MPS type VII	Sly syndrome	Beta-glucuronidase	3.2.1.31

Back to List

Author

Janette Baloghova, MD, PhD Lecturer, Dermatovenerologist, Medical Faculty, University of PJ Safarik; Department of Dermatovenerology, University Hospital of L Pasteur, Košice, Slovak Republic

Disclosure: Nothing to disclose.

Coauthor(s)

Robert A Schwartz, MD, MPH Professor and Head of Dermatology, Professor of Pathology, Professor of Pediatrics, Professor of Medicine, Rutgers New Jersey Medical School

Robert A Schwartz, MD, MPH is a member of the following medical societies: Alpha Omega Alpha, American Academy of Dermatology, New York Academy of Medicine, Royal College of Physicians of Edinburgh, Sigma Xi, The Scientific Research Honor Society

Disclosure: Nothing to disclose.

Zuzana Baranova, MD, PhD Senior Lecturer, Department of Dermatology, University of PJ Safarik at Kosice, Slovak Republic

Disclosure: Nothing to disclose.

Specialty Editor Board

David F Butler, MD Former Section Chief of Dermatology, Central Texas Veterans Healthcare System; Professor of Dermatology, Texas A&M University College of Medicine; Founding Chair, Department of Dermatology, Scott and White Clinic

David F Butler, MD is a member of the following medical societies: Alpha Omega Alpha, American Academy of Dermatology, Association of Military Dermatologists, Phi Beta Kappa, Texas Dermatological Society

Disclosure: Nothing to disclose.

Jeffrey J Miller, MD Associate Professor of Dermatology, Pennsylvania State University College of Medicine; Staff Dermatologist, Pennsylvania State Milton S Hershey Medical Center

Jeffrey J Miller, MD is a member of the following medical societies: Alpha Omega Alpha, American Academy of Dermatology, Society for Investigative Dermatology, Association of Professors of Dermatology, North American Hair Research Society

Disclosure: Nothing to disclose.

Chief Editor

Dirk M Elston, MD Professor and Chairman, Department of Dermatology and Dermatologic Surgery, Medical University of South Carolina College of Medicine

Dirk M Elston, MD is a member of the following medical societies: American Academy of Dermatology

Disclosure: Nothing to disclose.

Additional Contributors

Jacek C Szepietowski, MD, PhD Professor, Vice-Head, Department of Dermatology, Venereology and Allergology, Wroclaw Medical University; Director of the Institute of Immunology and Experimental Therapy, Polish Academy of Sciences, Poland

Disclosure: Received consulting fee from Orfagen for consulting; Received consulting fee from Maruho for consulting; Received consulting fee from Astellas for consulting; Received consulting fee from Abbott for consulting; Received consulting fee from Leo Pharma for consulting; Received consulting fee from Biogenoma for consulting; Received honoraria from Janssen for speaking and teaching; Received honoraria from Medac for speaking and teaching; Received consulting fee from Dignity Sciences for consulting; .

Acknowledgements

The authors and editors of Medscape Reference gratefully acknowledge the contributions of previous author, Alexander Halagovec, MD, PhD, to the development and writing of this article.